pmonster pmonster
  • 25-04-2018
  • Mathematics
contestada

Tony likes to collect colored string. Draw a line plot to show the lengths of his string

Tony likes to collect colored string Draw a line plot to show the lengths of his string class=

Respuesta :

MrEquation
MrEquation MrEquation
  • 04-05-2018
For a line plot, you will start with just a basic number line.  Since you have fractions, you could divide up the numbers into 1/4, 1/2 and 3/4 between each whole number. 

Then, place a dot above each number for the numbers that you have. You will have 2 dots above 3 and 1/2.
Answer Link

Otras preguntas

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
1. Why is soap better than hand sanitizer for combating the Coronavirus? 2. Why should we not completely abandon hand sanitizer for combating the Coronavirus?
Name the notes (look at the clef)​
If Tom Parsons traveled 232 miles in 4 hours, how many miles should he travel in 8 hours at the same rate of speed? Write a proportion and solve.
A nail that is rectangular in cross section and has a blunt point is called a
Read the excerpt from "Like Mexicans." We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congr
Do you think using the Atomic bombs against Japan were necessary? why or why not how do you think war alters people sense of what is right and wrong ?
Will give BRAINLIEST!!
Consider the equation x +1 = 2.Rewrite the equation by multiplying both sides by x +1DO NOT USE A MULTIPLICATION SYMBOL​
Explain how to solve linear equations.