helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

why was fredrich von hayek against government intervention in an evonomy

BRAINLIST ANSWER- Sanjay needs 90 meters of fence to go around a rectangular garden. The length l of the garden is three times its width w. Three of these equat

35% off what numner is $572?

Can you help me on questions 2 and 3 ASAP.

Habeas Corpus is an important law relating to prisoners' rights. true or false?

What is the tallest mountain in the world

factor completely and then place the factor. in the proper location on the grid (4x-+3)(-2x-5)

According to Charles Darwin’s theory of natural selection? a. people control evolution. b. nature picks the best species. c. the strongest species survive. d

which of the following should always be capitalized? a.) adjectives made from proper nouns b.) the words street, Road, and Boulevard c). all pronouns d.) all wo

A group of conducting wires or lines over which electrical signals corresponding to data and instructions are transmitted is