zykerianichols zykerianichols

24-09-2021
Biology

contestada

Why shouldn’t you keep your emergency fund money in your checking account?

Respuesta :

dibduhscjubf dibduhscjubf

24-09-2021

Answer:

im guessing its bc you might accidentially spend it??

Explanation:

Answer Link

jenn5586 jenn5586

24-09-2021

the interest earned in a checking account is less than the inflation rate, then our cash won't be able to buy as much as it used to, so an emergency fund saved in a checking account actually

Answer Link

Otras preguntas

at 2 p.m. the temperature is 18 degrees Fahrenheit at 10 p.m. the temperature is -9 degrees Fahrenheit what is the change in temperature between from 2 to 10 p.

margo had 6/8 of a whole pizza from last night's dinner, she ate 2/8 of the pizza for lunch. what fractional part of the leftover pizza did margo eat for lunch?

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

What is the Greatest Common Factor (GCF) of 27 and 63? A. 3 C. 9 B. 12 D.18

why is a political map more likely to change than a physical map

In a chemical compound, what things are being put together?

Long answer questione0 Write a letter to your friend describing theimportone of community

Rashad is having a picnic for 62 guests. He plans to serve each guest at least one hamburger. If each package, p, contain eight hamburgers, write the inequality

h(x)=-2x-4,find h (-2)

What is the length of EF ?