montgomerybunston montgomerybunston

22-09-2020
Biology

contestada

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

Respuesta :

oceanbluewater3000 oceanbluewater3000

22-09-2020

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

Answer Link

Otras preguntas

use the model to find 3x126

Rite 3 sentences. One useing the word pig. One useing the word fig. One useing the word dig.

how can I subtract fractions using the arrow way 2 2/5-4/5

a hot air ballon descended 99.6 meters in 21 seconds what was the balloons average rate of descent in metters per second

write in expanded form 3.124

5000 ones equals how many thousands

Two spherical balloons are filled with water. The first balloon has a radius of 3 cm, and the second has a radius of 6 cm. How much more water is in the larger

Who gave the famous "Cross of Gold" speech that advocated for the coinage of silver? A. James Garfield B. William McKinley C. Booker T. Washingt

compare and contrast the egalitarian society to modern society

Why is it important for a new nation to have a strong leader?