ac8954 ac8954
  • 25-06-2021
  • Mathematics
contestada

Can someone help me? It's urgent and thank you!

Can someone help me Its urgent and thank you class=

Respuesta :

chibunduoyibe
chibunduoyibe chibunduoyibe
  • 25-06-2021

Step-by-step explanation:

the first option is the answer

it can be gotten by multiplying 2/6 by 100%

since there are 2 o's in school

Answer Link

Otras preguntas

0.75x + 3 = 0.25x + 5.25
How can you increase the rate of a chemical reaction
How old was harriet tubman when she first escaped slavery?
The idea that government is not above the law is an example of rule of law. federalism. limited government. guaranteed rights.
In the following sentence, identify the italicized prepositional phrase as either an adjective phrase or an adverb phrase. We played Hide-and-Go-Seek under the
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
What type of mixture is a fruit salad​
Ben is assigned by his employer to improve an ultrasonic range-finding device. While working on the improvement, he recognizes that a novel modification of the
Consider the steps to solve the equation. 2 5 ( 1 2 y + 20 ) − 4 5 = 9 20 (2y − 1) Distribute: 1 5 y + 8 − 4 5 = 9 10 y − 9 20 What is the next step after using
Which event discussed in this lesson (Conflict on the Frontier, Cotton and Cattle, Challenges and Progress, or Age of Oil) do you believe had the most lasting i