falonfarmer81 falonfarmer81

22-03-2021
Chemistry

contestada

a car motor running as a car travels down the road.
Kinetic Energy
Potential Energy

Respuesta :

adamsreezy adamsreezy

22-03-2021

Answer:

kinetic energy

Explanation:

force is used

Answer Link

Otras preguntas

Arnold is reviewing the Miller-Urey experiment and similar experiments on the origins of life on Earth. In each of these experiments, several inorganic gases we

A 32-m tall building casts a shadow. The distance from the top of the building to the tip of the shadow is 35 m. Find the length of the shadow. If necessary, ro

Questions 2-10 15 points will mark as brainlist if does all

i need to find the slope

How did the “arms race” impact American Citizens and culture in the early decades of the cold war

Sporting Equipment, Inc. makes two types of balls: Soccer balls and Cork balls. The making of each soccer ball and cork ball requires 3 hours and 4 hours of pro

You will write a poem about any subject of your choice using any of the forms and styles that you read about. Part A Spend some time brainstorming a topic that

Look at this square. Find the value of p.Perimeter = 24 yardsP =yards

All sulfate minerals contain the elements O A. sulfur and two carbon atoms O B. sulfur and four oxygen atoms O C. silicon and oxygen O D. carbon and three oxyge

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please