sundussirat08 sundussirat08

21-10-2020
Biology

contestada

About how wide are the growth rings for the Rainy years.

Respuesta :

helterbrande helterbrande

21-10-2020

Answer:

About 0.6 cm 5.

Explanation:

Answer Link

Otras preguntas

Use the Associative, Commutative, and Distributive properties to write an equivalent expression in simplest form of the expression 2x + 8 + 3x - 3

Need help anyone! Will mark Brainliest

What is the slope of the line? Helppp

Ava deposited $3,500 in an account that earned 4.375% interest compounded annually. Ava did not withdraw any money from this account and she did not make any de

Which scientific method involves taking measurements

compare the density of 25g of copper to 80g of copper?

How do decisions concerning the allocation and use of resources impact individuals, groups, and relationships? Please I need this by 8:25

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

HELP ME PLZ What is needed for water vapor to condense into water droplets and form clouds ? A.When water vapor rises with warm air, it cools and loses its capa

1 kg = ___ g what is it