jazz7505 jazz7505
  • 21-12-2018
  • Mathematics
contestada

Two friends ordered a restaurant special in which they each recived a meal and shared a desert. The final bill with tax and tip was $21.86.How much should each friend pay

Respuesta :

tori1981
tori1981 tori1981
  • 21-12-2018
$10.93 is the answer I got you divide $21.86 by 2
Answer Link

Otras preguntas

I need help with just number 9
In the late 1800 hiw did the federal government respond to the southerners attempts to limit African American voting
What is the relationship between a sedimentary rock and deposition?
Solve for angle P and if you don’t mind to explain how
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
What structural decision does William Carlos Williams make in “Landscape with the Fall of Icarus” that makes the poem seem short and quick?
What is the volume of a sphere with a radius, r = 0.5? Use 3.14 for a and be sure you round your answer to two decimals. TO
How have you dealt with uncertainty in the past give at least a one paragraph response
Each student in Ms. Conroy’s class has a box of 48 markers. There are 23 students in the class. Lisa and Eva write the expressions below to find how many marker
Help me with this question for brainliest please