croitru7857 croitru7857

25-02-2018
Biology

contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422

25-02-2018

gtaaccatccgttttcttga

Answer Link

Otras preguntas

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?

what goal of the constitution was also a goal of the Magna Carta?