erikpaynee6047 erikpaynee6047

22-02-2018
History

contestada

What does lippman find problematic with x's analysis of the soviet union?

Respuesta :

lipi7ov7kpb lipi7ov7kpb

06-03-2018

Said X misunderstood the sources of Soviet behavior. Much more skeptical that a policy of containment will work. Said we should prepare for the worst (i.e. they are strong) rather than the best (i.e. they are weak)

Answer Link

Otras preguntas

Prompt Describe the different techniques that are used to construct skyscrapers. As building materials improved, what other buildin... Read More >>

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

After a 20% decrease, a number is 192

What were two box office hits that Guillermo del Toro was scheduled to direct but did not?

If BC= 5x, CD = 8, and BD = 7x, what is BD?

what are two reasons england passed the 4 acts

15.84 + 156 =?? Pls help

Tonya buys sodas that cost her $0.415 each. She sells them for $1.00 each. What is the markup? (Remember, the markup is the percent of increase. Round to 2 deci

Sulfur trioxide dissolves in water, producing H2SO4. How much sulfuric acid can be produced from 13.7 mL of water (d= 1.00 g/mL) and 25.7 g of SO3? How much of

Given line E has a slope of m = 3, what is the slope of a line perpendicular to line E