Sunnyxo Sunnyxo

22-06-2015
Biology

contestada

Suggest how the reflex action of the eye to bright light is useful to the body.

Respuesta :

3chiefs 3chiefs

25-06-2015

if a car of some sort is coming and they have their headlights on they could see to move out of the way that's partly why headlights were ceated

Answer Link

Otras preguntas

Dawnell is a skilled dancer. She is currently teaching modern dance full time for three high schools and makes $44,000 a year. She is now giving up her work and

The Present Perfect tense is observed is which of the examples below? I. Sasuke and Naruto have known each other since they were at school.II. My mother will ma

1. We (have made, had made, will have made) our Parents proud by studying hard since we were in the elementary grades.2. Despite our busy schedule, we (have spe

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

What is the place value of the 1-digit in the number 24.91?

If a nation is rich in resources then it can be developed justify this statement

Salad vegetables are cut and placed in plain water. Why?

Which row of the table reveals the y-intercept of function f?

A survey related to presidential favorability was administered to members of the same party as the president. The results of the survey showed 85% favorability.

A university dean of students wishes to estimate the average number of hours students spend doing homework per week. The standard deviation from a previous stud