gehringerfelici gehringerfelici

26-05-2017
Biology

contestada

As you increase the temperature of a lake, the amount of dissolved oxygen _____.
Is not affected
Stays the same
Increases
Decrease

Respuesta :

Brigat71 Brigat71

26-05-2017

Increases would be your answer

Answer Link

Otras preguntas

7. A game is played with 2 fair number cubes. One cube has faces numbered 1 through 6. The second number cube is numbered 4 through 6, and each number is marked

QUESTION 20 PLEASE HELPPPP ASAPPPP

Based on the passage, what type of literature is beowulf? which of these lines from the poem describes beowulf?.

What has to be broken before you can use it?

Can someone help me with this please

John Brown a. leader of an 1831 slave revolt in Virginia b. author of UNCLE TOM'S CABIN c. operator of a station on the Underground Railroad d. first Republ

Which answer best describes the complex zeros of the polynomial function? f(x) = 13 - 22 + 6x - 6 The function has two real zeros and one nonreal zero. The grap

pls help me with this:((((

Which of the following is an example of an incremented sequence? A. 1, 2, 3, 4 B. 4, 3, 2, 1 C. North, South, East, West D. A, B, C, D

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):