gamingmaniac261 gamingmaniac261
  • 22-05-2017
  • Mathematics
contestada

I will give 40 points for the answer! I really need help can you simplify 15^18 by 15^3

Respuesta :

bumbulbee123 bumbulbee123
  • 11-06-2017
1,477,891,880,035,400,390,625 by 3,375
or 4,987,885,095,119,476,318359,375
Answer Link

Otras preguntas

What is the vapor pressure of water at 750C?
what is The Original Price of an item if it is discounted 36% and the selling price is 32$
what is similarities and differences freedmen and serfs?
what does the root word boton mean
Which Of The Following Can Be Found In Breast Milk? 1. Vitamin D 2. Calcium 3. Anti Bodies 4. Iron
why did the united states fail to join the league of nations
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The gradient of a stream depends on its
How are glial cells and neurons alike and how are they different. Give 3 sentences for each
which simple machines is NOT a wedge?