scottrn9696
scottrn9696 scottrn9696
  • 22-09-2022
  • Mathematics
contestada

Solve the following equation. 2x + 1 < 9

Respuesta :

alliegsweetascanbe
alliegsweetascanbe alliegsweetascanbe
  • 22-09-2022

Answer:

x<4

Step-by-step explanation:

the answer is x<4trust me

Answer Link
cupcakepony768 cupcakepony768
  • 22-09-2022

Answer:

x < 4

Step-by-step explanation:

2x + 1 < 9

2x + 1 - 1 < 9 - 1

2x < 8

2x/2 < 8/2

x < 4

Hope this helps! :)

Answer Link

Otras preguntas

who sings Don't let me down
Inside which command group will a user find the ability to configure Outlook rules used to organize a mailbox?
6×3/16fraction in simplest form​
what happened to jonas and gaberial at the end of the giver or just give me what u think that happpedn
7.57, point, 5 liters of a certain solution contain 37 3737 grams of salt. What is the density of salt in the solution?
List and explain four effects of the Watergate scandal and its aftermath on American government and society
HELP QUICK PLZ Which of the following is one of the reasons for the fall of the Ottoman Empire?Lost battle to ConstantineRise of TurksNationalism in Eastern Eur
“Snorting is like hacking up hot coals." What figurative language is this?
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
Describe the smell, color, and temperature of the contaminated water