jadonwilliams08
jadonwilliams08 jadonwilliams08
  • 22-02-2022
  • Mathematics
contestada

Examining linear relationships

Examining linear relationships class=

Respuesta :

calsutherland23 calsutherland23
  • 23-02-2022
2, 1, -1,-1 and it is not proportional because -1 is repeated
Answer Link

Otras preguntas

to increase an amount by 85% what single multiplier would i need to use?
what is the property of 6x=72
Which of the following statements about tuberculosis is FALSE? A.It usually affects the digestive tract. B. It responds to a long course of antibiotic treatment
How many howl ones are equal to 36 quarters
If the unit selling price is 2.50 and the unit cost is 1.00, what action is needed to maintain the gross margin percentage when unit cost increases 0.25?
Make a phrase with each of them for me please 1) Beneficial 2) benefited 3) Breath 4) Brilliant Thank you so much ! Please , no grammars mistakes
what type of sentence is used to give a command
14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ