Maxine848
Maxine848 Maxine848
  • 22-11-2021
  • Social Studies
contestada

Can someone please help me I will give you 30 point and marked as brainliest if you answer correctly please also no links please

Can someone please help me I will give you 30 point and marked as brainliest if you answer correctly please also no links please class=

Respuesta :

abrahemgied1977 abrahemgied1977
  • 02-12-2021

I think A its my guess but I'm sorry I'm not sure

Answer Link

Otras preguntas

Can you pleas help me solve this assignment?
Please answer and put how
What is the layer of the earth where mantle convection occurs and on which the earth's crust rests?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Please I need help quickly I'm on a time limit
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening
Suggest a reason why food labels provide information about the energy released by the food?
Dree rolls a strike in 6 out of 10 frames of bowling. What is the experimental probability that Dree will roll a strike in the first frame of the next game? Exp
Why are they called SH2 domains?
SOMEONE HELP ME PLEASE!!!!!!!!! FIRST ONE TO ANSWER CORRECTLY GETS A BRAINLIEST ANSWERWhich sentence uses a verb that agrees with its compound subject? A. Ei