Seudónimo Seudónimo

21-06-2021
Spanish

contestada

Tú _____ español.

estudiáis

estudiamos

estudia

estudias

Respuesta :

66hello60 66hello60

31-07-2022

Answer: Estudias

Explanation:

Answer Link

Otras preguntas

Cuando hay necesidad de pedir dinero para ayudar a los pobres, we habla de A. El desplazamiento B. La solidaridad. C. Recolectar ropa. D. Recaudar fondos.

N4M.6 A board has one end wedged under a rock having a mass of 380 kg and is supported by another rock that touches the bottom side of the board at a point 85 c

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

What are examples of acceptable sources for an informative essay? Check all that apply. a biography of a public figure a blog run by a college student a website

A triangle ABC is reflected across the y-axis and then translated 5 units down to triangle A'B'C'. How are the side lengths of triangle ABC related to the side

The arms race meant that once the United States built hydrogen bombs, the Soviet Union built them too. world peace had been assured. no other country wanted to

Im not sure how to do this can someone please help me only answer if you know

Find the perimeter of the polygon. Please help

I need this quick please and thank you

A bel Match each example of an advertisement to the persuasive technique it is using. A pet food brand claims to use natural name-calling ingredients, unlike it