palmerzoey907 palmerzoey907
  • 26-03-2021
  • Mathematics
contestada

A line intersects the point (-3, -7) and
has a slope of -3. What is the
slope-intercept equation for this line?

Respuesta :

Yang100
Yang100 Yang100
  • 29-03-2021

Answer:

y=-3x-16

Step-by-step explanation:

y-y1=m(x-x1)

y-(-7)=-3(x-(-3))

y+7=-3(x+3)

y=-3x-9-7

y=-3x-16

Answer Link

Otras preguntas

With which statement about foreign policy would President Johnson most likely agree? Answer choices for the above question A. No country should be allowed to po
If cosine, theta, equals, one tenthcosθ= 10 1 ​ , then what is the positive value of cosine, one half, thetacos 2 1 ​ θ, in simplest radical form with a rat
What differing opinions did Johnson’s advisers have about Vietnam
Consider the neutron‑induced fission reaction.a. n + ⁹²U₂₃₅ ⟶ ³²Ge₈₀ + ⁶⁰Nd₁₅₄ +2nHow much energy, in megaelectronvolts, is released in this reaction? .
Describe the concepts of dualism and materialism and explain how they both are used in professional settings.
4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this
graph the inequity w 16
I need help with the following reactions
Which statements accurately explain why regulatory breakup of digital firms is likely to be ineffective?a. Companies in digital industries become obsolete and d
Which carbon dating technique dates only the time of rock formation? 1) Biostratigraphy 2) Isotopic measurement 3) Depth profiling 4) Radiometric dating