tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

28 elementary schools to 16 middle schools

Plz answer this easy question for Branilist!

The population of bacteria in a certain culture can be modeled by the function P(t)=10000(1.03)^t. What is the initial population of bacteria in the culture?

what number should be added to the expression x^2 + 10x to change it into a perfect square trinomial?

An example of a STATE issue would be the requirements for? A)printing money.B)getting married.C)running post offices.D)establishing an army.

Heather uses an ATM three times a week. She spends a week out of town for work every fifth week, and has to use an ATM that charges her $1.50 in service fees ea

15. What did Bismarck want to accomplish by having France attack Prussia?

One day a supplier supplied 300 units of a good at $20 per unit. A week later the same supplier supplied the same number of units at $10 per unit. Based on this

What is a estimate for 1/5 + 3/7

The ribosomes in eukaryotic cells are larger than the ribosomes in prokaryotic cells. Furthermore, eukaryotic ribosomes are not affected by some chemicals that