lillimm lillimm
  • 24-03-2021
  • Mathematics
contestada

PLS HELP!!!!!!!!!!!!!

PLS HELP class=

Respuesta :

ljubicasrdanovic ljubicasrdanovic
  • 24-03-2021
Answer:
Its the fourth x=-2w/v
Answer Link

Otras preguntas

in need of help pleaseee.!!!!
what is chemical reaction​
Jane was baking cookies. She needed 1/3 cup sugar and 1 2/4 cups flour. How much more flour does she need than sugar? (Common core)
Latte foam art, tiny pumpkins Fuzzy, comfy socks Coffee table made out of driftwood A bobblehead of Ruth Bader Ginsburg A needlepoint of a fox Some random quote
x 451 412 451 Find the value of x. A. 42 2 B. 4 C. 43 D. 43
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
1 torr is equal to (1 Point)​
Presto Corp. had total variable costs of $180,000, total fixed costs of $110,000, and total revenues of $300,000. Compute the required sales in dollars to break
Askew Company uses a periodic inventory system. The June 30, 2018, year-end trial balance for the company contained the following information: Account Debit Cre
Answer the following questions, 6 This question has two parts. First, answer Part A. Then, answer Part B. Part A From whose point of view is "Diary of a Decisio