vxonica100 vxonica100

26-02-2021
Social Studies

contestada

please helpp! answer as fast as you can please
(studies weekly grade 5, week 15)

please helpp answer as fast as you can please studies weekly grade 5 week 15 class=

Respuesta :

LuisaMaria LuisaMaria

26-02-2021

Answer:

The first method of keeping complete control was through the use of TERROR

Adolf Hitler

Benito Mussolini

Explanation:

Answer Link

Otras preguntas

The height in inches of three boys is 54.0 48.5 46.0 respectively the height of the 4th boy is denoted by h inches the average height a of the 4 boys can be exp

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what are the 3 care instructions for future life on earth

One +4 equals five, 2+5 = 12, 3+6 = 21, what does 8+ 11 equal

A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ

What two cell types do complement proteins interact with, besides the pathogen itself?

An essay that uses the words first, next, and finally indicates what type of organization?

find the value of x using the measures of the two given adjacent supplementary angles

Factor 3s+27t. Please help me I was absent for about a week with a high fever when she taught this lesson. I'm on 73% on IXL so PLEASE HELP!

if you are given a 2% raise and inflation rate is 3% you are