m2r1yQwsarasimo m2r1yQwsarasimo
  • 24-10-2016
  • Mathematics
contestada

Solve for the variable. -2x = -15

Respuesta :

radioheadfreak
radioheadfreak radioheadfreak
  • 24-10-2016
the variable is x=15/2
Answer Link

Otras preguntas

a 0.200-g sample of impure NaOH required 18.25ml of 0.2406 M HCl for neutralization. what is the percent of NaOH in the sample?
sam’s willingness to pay for a pizza is $15. if the price of pizza is $10, sam’s consumer surplus after buying the pizza is: a) $15 b) $0 c) $5 d) $20
The Spamhaus chapter described common reasons why companies don't like to come forward with a lot of details about a cyber breach to their business. Which of th
What strategies would you employ to determine the location of a business in a country that is not your county of origin?
100 pJ of energy is stored in a 3.0 cm × 3.0 cm × 3.0 cm region of uniform electric field. What is the electric field strength? Express your answer using two si
Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:
Maddy has 1655 apples she gives her 25 friends he same amout how much did each friend get
dance movements that are done with flat-feet and exhibit gliding, dragging, or shuffling steps can be traced back to....... group of answer choices a.russian da
What did Vietnamese nationalist hope to achieve?
Find an equation for the set of points in an xy-plane that are equidistant from the point P and the line l. P(−9, 2); l: x = −3