potato234333
potato234333 potato234333
  • 22-11-2020
  • Mathematics
contestada

compare linear and nonlinear functions

Respuesta :

oliviargraham27
oliviargraham27 oliviargraham27
  • 22-11-2020
Answer:
linear functions have no exponents higher than 1, and a graph that looks like a straight line. non-linear functions have at least one exponent higher than 1, and a graph that isn't a straight line.

I hope this helped :)
Answer Link

Otras preguntas

which show a set of prime factors A. 2, 17 B. 2, 4, 5 C. 4, 11 D. 2, 25
Which statement describes the location of the Isthmus of Panama?
Can some explain DNA replication??
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
HELP!!!!! Answer this please in 20 mins!! 20 POINTS AND THE BRAINLIEST
What is the purpose of the foundational documents? (Declaration of Independence, The Constitution, etc.) Please Help! Thank you!
Please help I’ll mark brainliest! Each pairs of values in the table has the same ratio what is the missing value in the table? X 14 21 28 Y 4. ? 8
About 33% of people who get their feet examined are found to have an ingrown toenail. What is the probability of a podiatrist examining seven people until he fi
A book resting on a table is an example of - * Kinetic energy O Thermodynamic energy O Potential energy O Electrical energy
Humans inherit traits from their parents. Where can the information about a person's traits be found?