adalsaad2004 adalsaad2004

21-11-2020
Mathematics

contestada

Given that €1 = £0.72
a) How much is €410 in £?
b) What is the £ to € exchange rate?

Respuesta :

yasmitadp yasmitadp

21-11-2020

Answer:

Step-by-step explanation:

a. Given €1=£0.72

€410 = £410×0.72 = £295.20

b. £1 = €1/0.72 = €100/72 = €1.39

Answer Link

Otras preguntas

If _________ is constrained, we should __________ the staffing level to lower capacity.

what were some acts of rebellion that the colonists took against the intolerable acts?

Sinus cavities are located _____ and _____ the nasal cavity. Please help

Which of the following statements describes how the crisis in Berlin in 1948–1949 was concluded? a.Berlin was united and made a part of East Germany. b.The West

History- why was it easy for England to take control of New Amsterdam?

A student solved this problem by working backward. Jared has some flowers. He has 6 more red flowers than yellow flowers. He has twice as many orange flowers

An someone help me with #10 I am super confused I’ll give the brainliest! If you can’t see the pic: The problem is A theme park has a ride located in half a sp

???? is what formed the stars, galaxies, and solar systems

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Una merienda que los venezolanos comen diariamente es _____. Las arepas tuyas son mejores. cereal hallaca arepas hervido