gyimahstargee6
gyimahstargee6 gyimahstargee6
  • 25-10-2020
  • English
contestada

l know him too well
"too well"
a) What is its grammatied name
b) What is its function​

Respuesta :

Pwpeoelelwowlwlwwp Pwpeoelelwowlwlwwp
  • 25-10-2020

It means to be familiar with something.

Answer Link
Kylenskipper09 Kylenskipper09
  • 25-10-2020
Yea to be familiar with something
Answer Link

Otras preguntas

A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you
In hexagonal writing and analysis of literary devices explores
What might "tangible artifacts" tell us about the Shang?
Explain how the delay in marching through Belgium helped France to Survive.
what would you use chromatography for?
what continenf is at 60 south and 60 east
Can somebody please explain to me how the acceleration in simple hormonic motion is proportional to the displacement..
the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch
to increase an amount by 85% what single multiplier would i need to use?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC