abbyddddd abbyddddd

23-10-2020
Mathematics

contestada

Solve the system of equations.
Choose your method:
2x - y = 7
x - y = 10

Respuesta :

Peterfruloo Peterfruloo

23-10-2020

-8y is the answer....

Answer Link

Otras preguntas

x and Y intercept equations x +2y =18

if you were lost at sea and you drank salty seawater, what would you expect to happen to the cells in your body?

2) Equations can have either 0, 1 or infinite number of solutions. Give an example of the following: 1) An equation with zero solutions 2) An equation with exac

ANSWER THIS QUICK QUESTION FOR 16 POINTS! In parallelogram A B C D, measure of angle A D C equals 60 degrees. What is measure of angle D C B?

Solve. Show work please. Passing through (-4,-1) and (3,4)

I need to know how to prove if an angle is congruent or not.

What is the economic and societal impact of bacteria? Why is it and has been so important for bacteria to evolve?

Read this passage: Dating applications for smartphones have become wildly popular in recent years. Most of the single people we surveyed in recent years said th

Which statement is not true of Georgia A : it was established as a buffer B : English prisoners found the colony as a safe heaven C : the colony was founded b

DNA tacaggtacccgaacccaattta