aadil0siddique aadil0siddique
  • 22-10-2020
  • Mathematics
contestada

Please help me!!!!!!!!!

Please help me class=

Respuesta :

218585
218585 218585
  • 24-10-2020

Answer:

-2/3

Step-by-step explanation:

I think this would help u

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
plz help what is the answer.
The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e
can organisms naturally repair a mutation?
Joe has eaten of a pizza. Jane has eaten of a pizza How many times more pizza has Joe eaten than Jane?
1.True or false: It may be possible to save a significant proportion of Earth's biological diversity by establishing sustainable biological reserves at 25 locat
what are the best study tips for Sol or finals
Explain which one of the above market control measures is applicable in the Labour market and justify why it is important to consider the effects of such action
How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac
Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?