nickger26 nickger26

25-09-2020
Mathematics

contestada

will mark brainlest if right. look at problem. (f•g)(x)

will mark brainlest if right look at problem fgx class=

Respuesta :

shyperson100 shyperson100

25-09-2020

I believe the answer would be B

Answer Link

Otras preguntas

The most ideal way to perform a two-point turn is by: A. Backing into a driveway on your right B. Driving forward into a driveway on your right C. Driving forwa

In describing his experiences during the decision making process that preceded the disastrous bay of pigs invasion, kennedy's adviser, arthur schlesinger, repor

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

The _____ biome is the driest. Common floras are cacti, and faunas are snakes and lizards. A.) grassland B.) desert C.) tundra D.) temperate deciduous forest

What mixed number does it show?

What is the % (w/v) concentration of a solution containing 12 grams of solute in 400 ml of solution?

Which of the following should you do to make an argument effective? 1. Compare the opposite side views to something unpleasant . 2. Include only general d

x/2=40/16[tex] \frac{x}{2} = \frac{40}{16} [/tex]

what clues tell Scout that the man in the corner is not a countryman?

a plumber charges $50 to make a house call. he aslo charge $25.00 per hour for labor B.how much it cost for a house call that requires 2.5 hours of labor C. if