eduardogarcimora5999 eduardogarcimora5999

22-05-2020
Physics

contestada

What effect can be observed in a planet's speed in its orbit as it travels away from the Sun?
A increases
B. remains same
C. decreases
D. unpredictable

Respuesta :

InsertNameHere7575 InsertNameHere7575

22-05-2020

Answer:

C

Explanation:

If I am wrong I will get your points back. But I am sure I am right.

Answer Link

farinkiny farinkiny

22-05-2020

Answer:

C. decreases

Explanation:

Answer Link

Otras preguntas

Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what was the key philosophy held by founding fathers

explain the conditions for cloud formation

of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why

what does beowulf offer hrothgar as a prize

Where can the resource for this ocean type be found?

14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?

Dree rolls a strike in 6 out of 10 frames of bowling. What is the experimental probability that Dree will roll a strike in the first frame of the next game? Exp

What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?