faith6789 faith6789
  • 22-05-2020
  • Mathematics
contestada

935 written in exponential form is :

Respuesta :

regretfulderey
regretfulderey regretfulderey
  • 22-05-2020

Answer:

[tex]9.35\times10^{2}[/tex]

simply find the exponent

Answer Link

Otras preguntas

What structural part of a bacterial flagellum is composed of flagellin?.
Thank you for your help you are wonderful
During which phase of the cell cycle is dna copies or replicated?.
Pls I need an answer with explanation, do the steps on how you got the answers!!
Supply Chain Performance : Achieving Strategic Fit and Scope Questions You are in fruit business . Your customers are expecting all kind of fruit from different
SOS Which observations might be used to determine if a chemical reaction has occured? 1.property change 2.color change 3.odor change 4.all of the above
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
Many employers don't focus on an applicant's job skills. Instead, they say the most important thing is _____. A. The perfect résumé b. The best previous work ex
Which option describes one of the costs to Native Americans as a result of the gold rush? (HURRY PLEASE) A. Many died from diseases. Many died from diseases. B.
What sort of text is used in the article Starting Small? Informational Text Poem Play Short Story