samorisanders2007
samorisanders2007 samorisanders2007
  • 22-04-2020
  • Mathematics
contestada

Is 43 a composite number

Respuesta :

Аноним Аноним
  • 22-04-2020

Answer:

43 is not a composite number

Step-by-step explanation:

43 is a prime number

Answer Link

Otras preguntas

Females with the genotype X^CBX^cb (heterozygous for the red-green colorblindness allele) are rarely colorblind although some have only partial color vision. Sp
dont knwo the answers for question 4,5,6
how would living in Sparta or Athens be like
john bought a used truck for $4,500 he made an agreement with the dealer to put $1,500 down and mae payments of $350 for the next 10 months the extra cost paid
I need somebody's help..
The shift from agriculture to industrialization illustrates that __________. A. land has become scarce B. economies change over time C. society has become more
Compare and contrast the infection of a bacterial cell by a lytic bacteriophage with the infection of an animal cell by a retrovirus.
Why would Congress not seat newly elected senators and representatives from southern states?
What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC