ayyhiitsme ayyhiitsme

22-01-2020
Physics

contestada

What is the independent vanable on this
graph?
•both flow time (s) and temperature
(°C)
• only temperature ("C)
• only flow time (s)

What is the independent vanable on this graph both flow time s and temperature C only temperature C only flow time s class=

Respuesta :

josee1234 josee1234

22-01-2020

Answer:

The Temperature(°C) is the Independent variable.

Answer Link

Otras preguntas

1+4 = 5. 2+5=12. 3+6=21 8+11==?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What role does the media play in reporting human rights violations in the right manner

Pythagorean Theorem: Alex leaves home, travels 5 miles east, and arrives at the library. He leaves the library and travels 3 miles north to a friend's house.

what is similarities and differences freedmen and serfs?

What's a simple method to find the cube root of a number ?

If the unit selling price is 2.50 and the unit cost is 1.00, what action is needed to maintain the gross margin percentage when unit cost increases 0.25?

what would you call a object that makes people shut up

Do any of these represent a linear function (just state letters if they do)

what continenf is at 60 south and 60 east