vickynunesoliveira vickynunesoliveira

21-12-2019
Mathematics

contestada

If ΔABC ≅ ΔFDE, which of the following statements is true?

∠A ≅ ∠E
∠B ≅ ∠F
∠C ≅ ∠E
∠A ≅ ∠D

Respuesta :

rosethedog rosethedog

21-12-2019

Angle C is equivalent to Angle E. That is the only true one.

Answer Link

Otras preguntas

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

Mann Corporation decided to issue common stock and used the $120,000 proceeds to retire all of its outstanding bonds on January 1, 2017. The following informati

What ethnic group is struggling to establish an independent country for its people

Since ______________________and the firm's sales has been forecasted to increase by 10 percent for next year, its pro forma income statement and balance sheet f

PLEASE HELPPPPP!! Eddy needs a $3,000 loan in order to buy a car. Which loan option would allow him to pay the LEAST amount of interest? A) An 18-month loan wit

What’s the circumference of a circle with a radius of 8

The proportion of households in a region that do some or all of their banking on the Internet is 0.41. In a random sample of 1000 households from this region, l

Help me please I am not very good with angles

Sheep should sleep in a shed. This is an example of what type of figurative language? Question 9 options: hyperbole metaphor alliteration simile

3 Points What type of wholesaler provides physical facilities or an online location where buyers and sellers can come together to complete a transaction? O A. A