divasteam132 divasteam132

21-11-2019
Mathematics

contestada

at a shelter, 1% of the dogs are puppies. There are 8,900 dogs at the shelter. How many are puppies

Respuesta :

katiegwen14 katiegwen14

21-11-2019

89 of the dogs are puppies

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

why does a virus stay in a person for life, such as hepatitis

why are cancer causing factors in lifestyle and environment difficult to identify

Dree rolls a strike in 6 out of 10 frames of bowling. What is the experimental probability that Dree will roll a strike in the first frame of the next game? Exp

:Select the correct text in the passage .Which lines in this excerpt from Phillis Wheatley's poem "Goliath of Gath" contain examples of figurative language? The

Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner

why can't the position of an electron be determined with certainty?

jon eat 3/4 of a pizza how much pizza is left

Consider the following piecewise-defined function. f(x){x^2 -5, x<3

Which of the following statements about tuberculosis is FALSE? A.It usually affects the digestive tract. B. It responds to a long course of antibiotic treatment