thirdlapat82
thirdlapat82 thirdlapat82
  • 21-10-2019
  • Biology
contestada

someone help me with this :(

someone help me with this class=

Respuesta :

poopscooter352
poopscooter352 poopscooter352
  • 21-10-2019

Answer:

A: Adenine

T: Thymine

G: Guanine

C: Cytosine

P: Phosphate Group

S: Pentose Sugar

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
John Locke would have agreed with all of the following statements EXCEPT:
7.8 14. Give the inequality 7.9 15. Make d the subject of the formula: A cd Anyone know the answers to these two questions?
Why it is not possible to draw a square that is not a parallelogram
. Slope intercept for y minus 3x equals 19
The heart sounds S1 and S2 are...?
plot and steps for writing a comedy please!!!
Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?
What shape have at least 2 parallel sides
why are cancer causing factors in lifestyle and environment difficult to identify