Goku77
Goku77
24-09-2019
Mathematics
contestada
Can someone explain?
Respuesta :
Summmerrr
Summmerrr
24-09-2019
Hey! I would think it’s 120 degrees. Tell me if I’m right. :)
Answer Link
VER TODAS LAS RESPUESTAS ( 28+ )
Otras preguntas
I've been asked to write an essay on civil rights and to choose one that personally affects my life today and I need to get a quote from somebody. It says from
1. A parking meter that is 1.6 meters (m) tall casts a shadow 3.6 m long. At the same time, a tree casts a shadow 9 m long. 1.6 m 3.6 m 9 m What is the height,
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
I need reassurance that my answer is right. Is this a rotation? :')
64PT AND BRAINLIEST! Which of the following would produce a graph with no solution? | x | = − 5 | x | < 5 | x | < 5 | x | = 0
What is these 2 documents about?
Which answer best describes the complex zeros of the polynomial function? f(x) = 13 - 22 + 6x - 6 The function has two real zeros and one nonreal zero. The grap
What is the final amount if 700 is increased by 4% followed by a further 3% increase?
When dealing with business analysis, when there is a graph of two linear equations, what is the point of intersection called? a break-even point c. profit point
Need help asapA scientist has invented a robot to work on the seabed. According to his calculation, the armour of the robot can withstand a maximum pressure of
