hello1162 hello1162
  • 26-04-2019
  • Arts
contestada

who is this plz help​

who is this plz help class=

Respuesta :

nikolebabe12
nikolebabe12 nikolebabe12
  • 26-04-2019

Answer:

it is like some cartoon

Explanation:

Answer Link
ParanormalExaminer ParanormalExaminer
  • 26-04-2019

Answer:

looks like a frosted wheat  cereal coloring book

Explanation:

Answer Link

Otras preguntas

Color ___ indicates that one color is dominating a picture.
What is the layer of the earth where mantle convection occurs and on which the earth's crust rests?
Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?
Which Of The Following Can Be Found In Breast Milk? 1. Vitamin D 2. Calcium 3. Anti Bodies 4. Iron
Helena needs 3.5 cups of flour per loaf of bread and 2.5 cups of flour per batch of muffins. She also needs 0.75 cup of sugar per loaf of bread and 0.75 cup of
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A jewel case that holds 2 CDs is 140 mm x 120 mm x 9 mm. hat is the surface area of this jewel case?
Allergies are the most common type of immune system disorder. Describe an allergic reacion and explain why it may be harmful. (5 marks)
which of the following are examples of ways humans and plants have coevolved? Pick all that apply A. Humans have bred plants to use as food B. Plants provide a
What type of triangle is this?