liliaboop397 liliaboop397

26-02-2024
Mathematics

contestada

Which of the following is equivalent to the expression below?
A. 13 - 8x
B. 4
C. 13 + 8x
D. 13

Respuesta :

Otras preguntas

In 2013, the population of the state of New York was approximately 19.65 million, and the population of New York City was 8,406,000. In 2013, how many people in

A group of ants escaped from a picnic basket carried to the top of a mountain and thrived in this area where there were no other ants. Many years later descenda

Estimate the change in temperature of 5 m3 of air, due to an increase in pressure of 50 kPa. The initial temperature of the air is 158C at atmospheric pressure.

\angle x∠xangle, x and \angle y∠yangle, y are supplementary angles. \angle y∠yangle, y measures 156^\circ156 ∘ 156, degrees. What is the measure of \angle x∠x

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc

Most European countries offer a variety of programs for assisting working parents, which include paid maternity and paternity leaves, financial allowances for f

The heart muscle commonly weakens with age. What is a consequence of this fact? A) The heart beats faster but pumps with less force. B) Fatty deposits and ot

Some organisms, such as plants, algae, and cyanobacteria, produce their own food by absorbing the sun's radiation. These organisms are referred to as ________.

Question 7. Or you could solve question 7 and 8.

Evaluate the relative importance of different causes for the expanding role of the United States in the world in the period from 1865-1910