PrlGrcBylm07 PrlGrcBylm07
  • 25-08-2017
  • English
contestada

Example of future tense

Respuesta :

ChrisDaBeast ChrisDaBeast
  • 25-08-2017
She is going to read 

In this the verb go had been added to the sentence with an -ing ending making it plural.

She will drive

In this sentence the verb is had been changed to will to make drive a future tense.


Answer Link

Otras preguntas

During which stage of a thunderstorm does the most precipitation fall
An ecologist counts 75 cardinals in an area measuring 15 square kilometers. What is the population density of the cardinals?
Solve the following inequality –1 + 6(–1 – 3x) > –39 – 2x.
Find two possible factors for the estimated product of 1,600
I will mark as the brainliest answer
Choose three goods. Then predict whether they have elastic or inelastic demand at their current price. Next, determine their elasticity by creating a demand sch
what was the full date of the end of ww2?
law that need to be changed in canada
DNA tacaggtacccgaacccaattta
The length of a rectangle with an area of 1024cm squared. Work out the width of the rectangle