ilyabelll69331 ilyabelll69331

23-01-2024
Physics

contestada

A long straight conductor carries a current of 5 amperes. If the value of the magnetic field at a distance of 0.2 m away from the wire is 2 × 10^-6 T, find the value of n.
a. 4
b. 5
c. 6
d. 7

Respuesta :

Otras preguntas

What molecule is responsible for determining the fate of each cell

The majority of people that Muhammad came into contact with were A:Monotheistic B:Polytheistic C:A mixture of both

he percentage of children living in single-parent households in America’s five most populated cities is: Philadelphia 40.4%, New York, 30.5 %, Chicago 32.2%, Ho

why are cancer causing factors in lifestyle and environment difficult to identify

Discuss the consequences of poor wound management.

Need to know if these are correct, and if not what are the correct ones?

1+4=5,2+5=12,3+6=21, 8+11=

If luisa travel 5 miles west then 8 miles south then 2.5 miles west how far is she from where she started?

If luisa travel 5 miles west then 8 miles south then 2.5 miles west how far is she from where she started?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC