ArleneCharley3128 ArleneCharley3128

24-11-2022
Health

contestada

the dash diet is low in fat and sodium and rich in fruits, vegetables, and low-fat dairy products. complete each sentence by filling in the dash diet serving recommendations for each food group.

Respuesta :

Otras preguntas

plzzzzzzzzzz helpppppppppp its for markssss and iam died

⚠warning, there are multiple bots that spam links, that are usually written in a link shortening form (eg, b i t . l y, c u t . l y) do NOT click on those links

How significant were President Reagan's policies in ending the Cold War? Please Answer!!!!!!

what is the place name of 2 in 25

A triangle has vertices T(-2,4), E(6,2), and D(1,-1). Is ATED a right triangle? No, this is not a right triangle. Yes, because ED is perpendicular to DT which m

HELP ASAP !!!!!!!!!!!!111111

2x - 5y +10x - 2y + 3z solve.

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Can someone please help me? I don’t understand this at all :/

Mention two situations involving potential energy